Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4338837
End position: 4338872
Length: 36

DNA sequence
>NC_017200, from 4338837 to 4338872 (36 bp); Bacillus thuringiensis serovar finitimus YBT-020 CCTGTTGATCCTGTTGCTCCCGTTGATCCCGTTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4337001-4339091	Sequence	YBT020_22255 - collagen triple helix repeat domain protein (Protein is coded in complementary strand; from 4339091 to 4337001)