Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4357252
End position: 4357287
Length: 36

DNA sequence
>NC_017200, from 4357252 to 4357287 (36 bp); Bacillus thuringiensis serovar finitimus YBT-020 TCGCTTCTTTATTTGCTTCTTTACTCTCTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4357116-4357823	Sequence	YBT020_22355 - cell surface protein, iron transport associated (Protein is coded in complementary strand; from 4357823 to 4357116)