Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4380132
End position: 4380158
Length: 27

DNA sequence
>NC_017200, from 4380132 to 4380158 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 ACTTCTTTTTCTTCTTTTACTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4378578-4380377	Sequence	YBT020_22465 - multidrug resistance protein B (Protein is coded in complementary strand; from 4380377 to 4378578)