Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4497198
End position: 4497224
Length: 27

DNA sequence
>NC_017200, from 4497198 to 4497224 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 CTTCTACTTCTTCGACTTCTTCTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4496252-4497823	Sequence	YBT020_23080 - cell division protein (Protein is coded in complementary strand; from 4497823 to 4496252)