Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4539896
End position: 4539922
Length: 27

DNA sequence
>NC_017200, from 4539896 to 4539922 (27 bp); Bacillus thuringiensis serovar finitimus YBT-020 TGACCGTGGTGACCTTGGTGACCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4539841-4540128	Sequence	YBT020_23330 - hypothetical protein