Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 4576103
End position: 4576156
Length: 54

DNA sequence
>NC_017200, from 4576103 to 4576156 (54 bp); Bacillus thuringiensis serovar finitimus YBT-020 CTACCGGAAGCACTGGACCCACCGGCATCACTGGACCTACCGGCATCACTGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4575304-4576131	Sequence	YBT020_23530 - hypothetical protein (Protein is coded in complementary strand; from 4576131 to 4575304)