Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 5034790
End position: 5034834
Length: 45

DNA sequence
>NC_017200, from 5034790 to 5034834 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 TATCTTCTTTTTTAGGTGCTTCTTTTTTAGGCTCTTCCTTTTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5034414-5035973	Sequence	YBT020_25885 - endopeptidase lytE (Protein is coded in complementary strand; from 5035973 to 5034414)