Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 5131364
End position: 5131388
Length: 25

DNA sequence
>NC_017200, from 5131364 to 5131388 (25 bp); Bacillus thuringiensis serovar finitimus YBT-020 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5131338-5131610	Sequence	YBT020_26330 - stage III sporulation protein D (Protein is coded in complementary strand; from 5131610 to 5131338)