Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 527635
End position: 527679
Length: 45

DNA sequence
>NC_017200, from 527635 to 527679 (45 bp); Bacillus thuringiensis serovar finitimus YBT-020 CCATTGCCACCCGAACCATTGCCACCAGAACCATTGCCACCAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 527212-528294	Sequence	YBT020_02520 - surface protein (Protein is coded in complementary strand; from 528294 to 527212)