Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 622961
End position: 622984
Length: 24

DNA sequence
>NC_017200, from 622961 to 622984 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 GAAAAAGCAAAAGAAAAAGGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 621723-623792	Sequence	YBT020_02975 - sensory box/GGDEF family protein