Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 707692
End position: 707715
Length: 24

DNA sequence
>NC_017200, from 707692 to 707715 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 CTTTTTCTTCTTGTTTTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 706923-708542	Sequence	YBT020_03320 - L-lactate permease (Protein is coded in complementary strand; from 708542 to 706923)