Sequence retrieval

Genome: Bacillus thuringiensis serovar finitimus YBT-020
Start position: 809536
End position: 809559
Length: 24

DNA sequence
>NC_017200, from 809536 to 809559 (24 bp); Bacillus thuringiensis serovar finitimus YBT-020 TCTGCTTCTGCATATGCTTTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 808579-809994	Sequence	YBT020_03790 - amino acid permease (Protein is coded in complementary strand; from 809994 to 808579)