Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 2530491
End position: 2530514
Length: 24

DNA sequence
>NC_017208, from 2530491 to 2530514 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 AAAGATAAAAATATAAAACGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2529554-2530570	Sequence	CT43_CH2482 - D-alanyl-D-alanine carboxypeptidase (Protein is coded in complementary strand; from 2530570 to 2529554)