Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3802374
End position: 3802397
Length: 24

DNA sequence
>NC_017208, from 3802374 to 3802397 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 TCTTTTTGTTTTTCTTGTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3802287-3802430	Sequence	CT43_CH3777 - Phage protein (Protein is coded in complementary strand; from 3802430 to 3802287)