Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4495984
End position: 4496007
Length: 24

DNA sequence
>NC_017208, from 4495984 to 4496007 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 TTATCTTTATCCTTATTTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4494916-4496142	Sequence	CT43_CH4528 - Sodium export permease protein (Protein is coded in complementary strand; from 4496142 to 4494916)