Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4712806
End position: 4712829
Length: 24

DNA sequence
>NC_017208, from 4712806 to 4712829 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 GCTGCTCCTGCTGCTGCCCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4712761-4713726	Sequence	CT43_CH4759 - VrrB (Protein is coded in complementary strand; from 4713726 to 4712761)