Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4791669
End position: 4791692
Length: 24

DNA sequence
>NC_017208, from 4791669 to 4791692 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 TTCTCTTTTTCTCTTCTTCACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4791446-4791934	Sequence	CT43_CH4841 - cell surface protein (Protein is coded in complementary strand; from 4791934 to 4791446)