Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4919961
End position: 4919984
Length: 24

DNA sequence
>NC_017208, from 4919961 to 4919984 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 TAACCAATCAACCAATTCACCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4919017-4922409	Sequence	CT43_CH4954 - Phage protein (Protein is coded in complementary strand; from 4922409 to 4919017)