Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 763712
End position: 763735
Length: 24

DNA sequence
>NC_017208, from 763712 to 763735 (24 bp); Bacillus thuringiensis serovar chinensis CT-43 TCTGCTTCTGCATATGCTTTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 762755-764170	Sequence	CT43_CH0681 - arginine permease (Protein is coded in complementary strand; from 764170 to 762755)