Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 1474849
End position: 1474873
Length: 25

DNA sequence
>NC_017208, from 1474849 to 1474873 (25 bp); Bacillus thuringiensis serovar chinensis CT-43 AAAAATAAAATAAAAATAAAAAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1474648-1474857	Sequence	CT43_CH1419 - hypothetical protein