Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 2531653
End position: 2531677
Length: 25

DNA sequence
>NC_017208, from 2531653 to 2531677 (25 bp); Bacillus thuringiensis serovar chinensis CT-43 AAAATAAAAACAAATAAGATACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2530746-2531903	Sequence	CT43_CH2483 - sensor protein vanS (Protein is coded in complementary strand; from 2531903 to 2530746)