Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 5267547
End position: 5267571
Length: 25

DNA sequence
>NC_017208, from 5267547 to 5267571 (25 bp); Bacillus thuringiensis serovar chinensis CT-43 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5267521-5267727	Sequence	CT43_CH5320 spoIIID stage III sporulation protein D (Protein is coded in complementary strand; from 5267727 to 5267521)