Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 5401394
End position: 5401418
Length: 25

DNA sequence
>NC_017208, from 5401394 to 5401418 (25 bp); Bacillus thuringiensis serovar chinensis CT-43 TTTCTTTTCTTTTATATTCTTTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5401287-5402858	Sequence	CT43_CH5452 - two-component sensor protein yhcY (Protein is coded in complementary strand; from 5402858 to 5401287)