Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 177228
End position: 177254
Length: 27

DNA sequence
>NC_017208, from 177228 to 177254 (27 bp); Bacillus thuringiensis serovar chinensis CT-43 CGTCTTTTAAGTCTTTTACATCTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 176807-177619	Sequence	CT43_CH0164 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 177619 to 176807)