Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3246863
End position: 3246889
Length: 27

DNA sequence
>NC_017208, from 3246863 to 3246889 (27 bp); Bacillus thuringiensis serovar chinensis CT-43 GGTACTGGTGGTACTGGTGGTACTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3246560-3247405	Sequence	CT43_CH3230 - hypothetical protein (Protein is coded in complementary strand; from 3247405 to 3246560)