Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3289066
End position: 3289092
Length: 27

DNA sequence
>NC_017208, from 3289066 to 3289092 (27 bp); Bacillus thuringiensis serovar chinensis CT-43 CCTGGTGGACCTGGTGGACCTGATGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3288112-3289539	Sequence	CT43_CH3276 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 3289539 to 3288112)