Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3473694
End position: 3473720
Length: 27

DNA sequence
>NC_017208, from 3473694 to 3473720 (27 bp); Bacillus thuringiensis serovar chinensis CT-43 AAGAAAAATAAGAAAAACAACAAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3471312-3474041	Sequence	CT43_CH3458 - sensory box/GGDEF family protein (Protein is coded in complementary strand; from 3474041 to 3471312)