Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3070277
End position: 3070312
Length: 36

DNA sequence
>NC_017208, from 3070277 to 3070312 (36 bp); Bacillus thuringiensis serovar chinensis CT-43 CCCTGAAACCATCCCTGTAACAATACCTGCAACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3069690-3070385	Sequence	CT43_CH3058 - permease (Protein is coded in complementary strand; from 3070385 to 3069690)