Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3807710
End position: 3807745
Length: 36

DNA sequence
>NC_017208, from 3807710 to 3807745 (36 bp); Bacillus thuringiensis serovar chinensis CT-43 GTTCTTCTTGTTGTTCTTTTTCTTTTTCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3807280-3808227	Sequence	CT43_CH3787 - Phage replication protein (Protein is coded in complementary strand; from 3808227 to 3807280)