Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 2604948
End position: 2604992
Length: 45

DNA sequence
>NC_017208, from 2604948 to 2604992 (45 bp); Bacillus thuringiensis serovar chinensis CT-43 TCCACAAGTGGAGAATCCACATATGGAAAATCCACAAGTGGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2604662-2605396	Sequence	CT43_CH2557 - Phage replication protein