Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3752060
End position: 3752104
Length: 45

DNA sequence
>NC_017208, from 3752060 to 3752104 (45 bp); Bacillus thuringiensis serovar chinensis CT-43 TTGCTCCTCTTTCTTTGGTTCTTCTTTCTTTGGTTCCTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3751704-3752615	Sequence	CT43_CH3725 - hypothetical protein (Protein is coded in complementary strand; from 3752615 to 3751704)