Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 443920
End position: 443964
Length: 45

DNA sequence
>NC_017208, from 443920 to 443964 (45 bp); Bacillus thuringiensis serovar chinensis CT-43 CCAGAACCATTGCCACCAGAACCGTTGCCACCAGAACCGTTGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 443467-444345	Sequence	CT43_CH0384 - surface protein (Protein is coded in complementary strand; from 444345 to 443467)