Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 2965219
End position: 2965272
Length: 54

DNA sequence
>NC_017208, from 2965219 to 2965272 (54 bp); Bacillus thuringiensis serovar chinensis CT-43 GCTTTTTCTTCTTCTTTAGCTTTTACTTCTTCTTTAGCTTTTACTTCTTCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2964643-2966187	Sequence	CT43_CH2954 - enterotoxin/cell-wall binding protein (Protein is coded in complementary strand; from 2966187 to 2964643)