Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4513710
End position: 4513763
Length: 54

DNA sequence
>NC_017208, from 4513710 to 4513763 (54 bp); Bacillus thuringiensis serovar chinensis CT-43 CCGGTTGCTCCCGTTGGACCCGTTGCTCCTGTTGGGCCTGTTGCTCCTGTTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4513152-4514216	Sequence	CT43_CH4546 - hypothetical protein (Protein is coded in complementary strand; from 4514216 to 4513152)