Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 4532759
End position: 4532818
Length: 60

DNA sequence
>NC_017208, from 4532759 to 4532818 (60 bp); Bacillus thuringiensis serovar chinensis CT-43 GGTTTTTCTACTTCTGGTTTTTCTGCTTCTGGTTTTTCTACTTCCGGTTTTTCTACTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4531160-4533820	Sequence	CT43_CH4567 - cell surface protein (Protein is coded in complementary strand; from 4533820 to 4531160)