Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 1026694
End position: 1026756
Length: 63

DNA sequence
>NC_017208, from 1026694 to 1026756 (63 bp); Bacillus thuringiensis serovar chinensis CT-43 TGTTCGTAATTCTTCAGCTTGCATTTGTAGTTCTTCAGCTTGCGTTTGTAATTCTTCTGATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1025372-1028062	Sequence	CT43_CH0943 - two component system histidine kinase (Protein is coded in complementary strand; from 1028062 to 1025372)