Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3105797
End position: 3105859
Length: 63

DNA sequence
>NC_017208, from 3105797 to 3105859 (63 bp); Bacillus thuringiensis serovar chinensis CT-43 CCTGGCCAACCACCATGTCCGCCTTGCCAGCCACCATGTCCGCCTTGCCAACCACCGTGTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3105761-3106060	Sequence	CT43_CH3096 - hypothetical protein (Protein is coded in complementary strand; from 3106060 to 3105761)