Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3223744
End position: 3223806
Length: 63

DNA sequence
>NC_017208, from 3223744 to 3223806 (63 bp); Bacillus thuringiensis serovar chinensis CT-43 TTTGGTTTTTGTACTTCTTCCTTAGGTTTTTGTACTTCTTCCTTAGGCTTTTGTACTTCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3223219-3225039	Sequence	CT43_CH3204 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 3225039 to 3223219)