Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 3773986
End position: 3774048
Length: 63

DNA sequence
>NC_017208, from 3773986 to 3774048 (63 bp); Bacillus thuringiensis serovar chinensis CT-43 GACCTGTTGGACCTGTTGGACCTGTTGGACCTGTTGGACCTGTTGGACCTGTTGGACCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3773448-3774158	Sequence	CT43_CH3744 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 3774158 to 3773448)