Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 2638701
End position: 2638772
Length: 72

DNA sequence
>NC_017208, from 2638701 to 2638772 (72 bp); Bacillus thuringiensis serovar chinensis CT-43 GGAGTAACGGGTCCAACAGGAGTAACGGGTCCAACAGGAGTAACGGGTCCAACAGGAGTAACGGGTCCAA CA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2638575-2639039	Sequence	CT43_CH2601 - hypothetical protein (Protein is coded in complementary strand; from 2639039 to 2638575)