Sequence retrieval

Genome: Bacillus thuringiensis serovar chinensis CT-43
Start position: 851994
End position: 852065
Length: 72

DNA sequence
>NC_017208, from 851994 to 852065 (72 bp); Bacillus thuringiensis serovar chinensis CT-43 TCTTGAGCTTTAGCTTCTGCTTGAGCTTCAGCATCTGCCTGAGCTTTAGCTGCTTCTTGAGCCTTAGCTG CT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 851436-852701	Sequence	CT43_CH0767 - enterotoxin/cell-wall binding protein (Protein is coded in complementary strand; from 852701 to 851436)