Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 13633
End position: 13656
Length: 24

DNA sequence
>NC_017252, from 13633 to 13656 (24 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) ATTTTTATTATTATTATTATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 12566-13930	Sequence	CWQ_00065 dnaA chromosomal replication initiation protein (Protein is coded in complementary strand; from 13930 to 12566)