Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 161803
End position: 161838
Length: 36

DNA sequence
>NC_017252, from 161803 to 161838 (36 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) CCACCAAAAATATCACCAAAAACATCCCCAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 160987-162120	Sequence	CWQ_00810 - chaperone protein DnaJ (Protein is coded in complementary strand; from 162120 to 160987)