Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 200905
End position: 200929
Length: 25

DNA sequence
>NC_017252, from 200905 to 200929 (25 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTTTTTATTTTTTCTATTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 200573-201139	Sequence	CWQ_00985 - heat shock protein GrpE2 (Protein is coded in complementary strand; from 201139 to 200573)