Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 211413
End position: 211442
Length: 30

DNA sequence
>NC_017252, from 211413 to 211442 (30 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTTTTTATAATTTTTTCTATTTCTTTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 209251-211701	Sequence	CWQ_01040 thrA bifunctional aspartokinase I/homoserine dehydrogenase I (Protein is coded in complementary strand; from 211701 to 209251)