Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 232709
End position: 232738
Length: 30

DNA sequence
>NC_017252, from 232709 to 232738 (30 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTTTTATTTCTTTTTTTATTATTTTTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 232637-233791	Sequence	CWQ_01140 - cell division protein FtsZ (Protein is coded in complementary strand; from 233791 to 232637)