Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 238089
End position: 238113
Length: 25

DNA sequence
>NC_017252, from 238089 to 238113 (25 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTATTATATTTTTTTTTAGTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 237715-238779	Sequence	CWQ_01170 murG undecaprenyldiphospho-muramoylpentapeptide beta-N- acetylglucosaminyltransferase (Protein is coded in complementary strand; from 238779 to 237715)