Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 337538
End position: 337561
Length: 24

DNA sequence
>NC_017252, from 337538 to 337561 (24 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) AATAATAAAAATAATAATAATAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 336996-338258	Sequence	CWQ_01615 - 2-oxoglutarate dehydrogenase E2 component