Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 353006
End position: 353029
Length: 24

DNA sequence
>NC_017252, from 353006 to 353029 (24 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) ATTATGAATATGATTATGATTATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 353001-353717	Sequence	CWQ_01695 - high-affinity zinc uptake system ATP-binding protein ZnuC (Protein is coded in complementary strand; from 353717 to 353001)