Sequence retrieval

Genome: Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum)
Start position: 41633
End position: 41662
Length: 30

DNA sequence
>NC_017252, from 41633 to 41662 (30 bp); Buchnera aphidicola str. TLW03 (Acyrthosiphon pisum) TTTTTCTATTTCTTTTTTTTTGTCTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 40644-44672	Sequence	CWQ_00190 rpoB DNA-directed RNA polymerase subunit beta (Protein is coded in complementary strand; from 44672 to 40644)